PHYLIP

1. Phylip is a phylogenetic analysis package written by Joe Felsenstein (you may recognize him from such phylogenetic concepts as "The Felsenstein Zone" and "The F84 Model").
   1. Phylip (like GCG) is a collection of small programs that each perform a relatively simple task.
   2. These programs can be used together to accomplish complex analyses, and the package includes analytical methods that are not available elsewhere.
2. The programs are installed on the University of Maryland AITS UNIX cluster at ~delwiche/bin/phylip.
   1. Use ls to view the components of the package.
      1. ls ~delwiche/bin/phylip
3. Unfortunately, the user interface is virtually non-existant, although once you learn phylip's peculiarities, it is easy to use.
   1. Phylip is available free, although you do need to register as a user.
   2. Be sure to do this -- it helps Joe justify his support.
4. Documentation is available locally in ~delwiche/bin/phylip/docs
   • ls ~delwiche/bin/phylip/docs
   • Read the general documentation for phylip:
   • more ~delwiche/bin/phylip/docs/main.doc
   • There is (approximately) one documentation file per program.
   • more ~delwiche/bin/phylip/docs/dnadist.doc
   • This will show you the documentation for dnadist, the program used to calculate distances from dna sequence data.
5. Notice that there is also a program to calculate distances from amino acid data:
   1. more ~delwiche/bin/phylip/docs/protdist.doc
6. To use these programs you will have to have an input file in phylip format.
   1. The basic phylip format data file consists of a file where the first line contains two numbers, the number of taxa, and the number of characters.
   2. There may also be some additional characters on this first line, which are used to control the behavior of the program (for example, if the data are interleaved, this must be indicated on the first line).
   3. Following the first line is the data matrix.
      1. The first ten characters (exactly!) of each line are the taxon name -- if the name is less than ten characters just add spaces.
      2. The taxon names are followed by data, i.e., nucleotide of amino acid sequences.

7 50 
thermotogaATGGCGAAGGAAAAATTTGTGAGAACAAAACCGCATGTTAACGTTGGAAC
TthermophiATGGCGAAGGGCGAGTTTGTTCGGACGAAGCCTCACGTGAACGTGGGGAC  
TaquaticusATGGCGAAGGGCGAGTTTATCCGGACGAAGCCCCACGTGAACGTGGGGAC 
deinonema-ATGGCTAAGGGAACGTTTGAACGCACCAAACCCCACGTGAACGTGGGCAC  
ChlamydiaBATGTCAAAAGAAACTTTTCAACGTAATAAGCCTCATATCAACATAGGGGC 
flexistipsATGTCCAAGCAAAAGTACGAAAGGAAGAAACCTCACGTAAACGTAGGCAC 
borrelia-bATGGCAAAAGAAGTTTTTCAAAGAACAAAGCCGCACATGAATGTTGGAAC