Lab for November 27, 2006

What can your bioinformatics skills help you learn about this sequence?

>sequence for 11/27/06
ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCATGGTGCTGTCTCCTGCCGACAAGACCAACGTC
AAGGCCGCCTGGGGTAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCC
TGTCCTTCCCCACCACCAAGACCTACTTCCCGCACTTCGACCTGAGCCACGGCTCTGCCCAGGTTAAGGG
CCACGGCAAGAAGGTGGCCGACGCGCTGACCAACGCCGTGGCGCACGTGGACGACATGCCCAACGCGCTG
TCCGCCCTGAGCGACCTGCACGCGCACAAGCTTCGGGTGGACCCGGTCAACTTCAAGCTCCTAAGCCACT
GCCTGCTGGTGACCCTGGCCGCCCACCTCCCCGCCGAGTTCACCCCTGCGGTGCACGCCTCCCTGGACAA
GTTCCTGGCTTCTGTGAGCACCGTGCTGACCTCCAAATACCGTTAAGCTGGAGCCTCGGTAGCCGTTCCT
CCTGCCCGCTGGGCCTCCCAACGGGCCCTCCTCCCCTCCTTGCACCGGCCCTTCCTGGTCTTTGAATAAA
GTCTGAGTGGGCGGC

Available here as a text file

This is the DNA sequence of a familiar human gene. Please analyze the sequence and provide as much information on it as you can. To help guide you, a number of questions are posed below. You should use any analytical tool you find helpful, including the ones you have used in previous labs and any others you find. One tool in particular that you should find helpful is the human genome browser at UCSC (http://genome.cse.ucsc.edu). An alternative is the NCBI genome browser.

What is the gene? In what gene family is it a member? How many loci encode members of this family in the human genome? How many functionally distinct proteins are coded by these loci?

On what chromosome is each located? In other words, how many family members are on each chromosome? Are they clustered within particular areas of individual chromosomes?

Are there any genetic diseases (i.e., functionally significant genetic variants) associated with any of the genes? If you do not find at least three, you are not looking hard enough. Can multiple loci result in the same observed phenotype?

A non-functional copy of a gene is called a pseudogene. Are there any pseudogenes in this gene family? Is there any useful information in the location of the gene and its flanking regions that can provide insight into the history of the pseudogene(s)?

One of the most useful tools for the study of gene families is phylogenetic analysis. What information about the relationships among the members of this gene family can you determine from phylogenetic analysis? Be sure to show the analyses that you performed, and document exactly what analytical methods you used.