|
|
Below is a segment of sequence from an unsequenced Pyrococcus library created by a researcher here at the University of Maryland. Tell its story as completely as possible. The story of this sequence will consist of a single map describing the sequence and up to three pages of text. Thus do not provide the outputs of the assorted programs used to test hypotheses, instead discuss hypotheses in the written text. Here are some guidelines to help in creating a map: Start codon: An Octagon Stop codon: * Intron region: Connect exons with ^ Exon region: A boxA successful assignment will demonstrate an ability to test multiple hypotheses and interpret the data from the tests. Use the process describes by Platt in order to tell a complete story about the sequence. For other ideas it may be useful to check out the Arabidopsis genome browser: http://atensembl.arabidopsis.info/Arabidopsis_thaliana_TIGR/ or the drosophila genome: http://www.ensembl.org/Drosophila_melanogaster/ ACGTCATGGTTAACGGCGACAAGCCTCCGGACGATTTTGATATTGAGATA ATAGTTGCAAAGCCCAAGAGGTTTAGGATAAAACCAGGAATTTACCAGAT GGCATGGCACCTTGTTTTCAAGGCTTATGGAGATGATGAGCTGATTAAAG TTGGCTATGTAGTTGGCTTTGGGGAAAAGAACTCGCTCGGCTTTGGAATG GTTAAAGTCGAGGGTGGTAAACGTGTATCGGGTGGAGTTAAAAGTAGAGT TATAACTCCGGCGTTTATCCGAGGAGCAGACCAGAAGAAGGCGGAGTTGA GGGTAGCGTTTACTAGAAGGAATAATTTATCTGCTAACTATCCTTCCTCT TATGAGTCCTCTATCAGAGAGGTGATTTTTCTATGTTGAAATTTACTGGC AACTGGTTCATAGATGCTGGCATTTTGGGGTTCGTGAATTTGATGGAAGA GGTTTACGGTTGGGATTTGGAGGAGCTTCAGAGACATATCAAAGAAGAGC CGGAGAAGGTCTATTATGGGTATTTTCCACTAGCTTACTTTTACAGTTTA GCACCCAAGGGCCAAGAGAACAAAGGGCTTCTCTTACAGGCTATGCAAGA AATAGAAACTTTTGAAGGAGACAAACATAAATTGCTCGAGCTCGTGTGG Created: Wed Sep 15 00:58:22 EDT 2004 by Chuck Delwiche |